The Future of Life

Author: Edward O. Wilson
Publisher: Vintage
ISBN: 9780679768111
Release Date: 2003
Genre: Nature

Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.

The Future of Life

Author: Edward O. Wilson
Publisher: Vintage
ISBN: 9780375414565
Release Date: 2002-04-09
Genre: Science

One of the world’s most important scientists, Edward O. Wilson is also an abundantly talented writer who has twice won the Pulitzer Prize. In this, his most personal and timely book to date, he assesses the precarious state of our environment, examining the mass extinctions occurring in our time and the natural treasures we are about to lose forever. Yet, rather than eschewing doomsday prophesies, he spells out a specific plan to save our world while there is still time. His vision is a hopeful one, as economically sound as it is environmentally necessary. Eloquent, practical and wise, this book should be read and studied by anyone concerned with the fate of the natural world.

The Future of Life

Author: Edward O. Wilson
Publisher: Knopf
ISBN: 9780679450788
Release Date: 2002-01-01
Genre: Nature

Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.

Life 3 0

Author: Max Tegmark
Publisher: Knopf
ISBN: 9781101946602
Release Date: 2017-08-29
Genre: Technology & Engineering

New York Times Best Seller How will Artificial Intelligence affect crime, war, justice, jobs, society and our very sense of being human? The rise of AI has the potential to transform our future more than any other technology—and there’s nobody better qualified or situated to explore that future than Max Tegmark, an MIT professor who’s helped mainstream research on how to keep AI beneficial. How can we grow our prosperity through automation without leaving people lacking income or purpose? What career advice should we give today’s kids? How can we make future AI systems more robust, so that they do what we want without crashing, malfunctioning or getting hacked? Should we fear an arms race in lethal autonomous weapons? Will machines eventually outsmart us at all tasks, replacing humans on the job market and perhaps altogether? Will AI help life flourish like never before or give us more power than we can handle? What sort of future do you want? This book empowers you to join what may be the most important conversation of our time. It doesn’t shy away from the full range of viewpoints or from the most controversial issues—from superintelligence to meaning, consciousness and the ultimate physical limits on life in the cosmos.

The Future of Life on Earth

Author: Michael Bright
Publisher: Capstone Classroom
ISBN: 9781410944337
Release Date: 2012-01-01
Genre: Juvenile Nonfiction

Looks at ways that human activity is affecting biodiversity and how that may play out in the future of life on Earth based on past instances of mass extinction, and also looks forward to the time when the Sun will no longer support life on the planet.

Creation

Author: Adam Rutherford
Publisher: Penguin UK
ISBN: 9780141970226
Release Date: 2013-04-04
Genre: Science

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The Future of Life Meta Evolution

Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut
ISBN: 9781425726843
Release Date: 2006-10-01
Genre: Science

The Future of Life: Meta-Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe, both organic and inorganic. These include all facets of human existence and civilisation- the sciences, technology, arts, humanities and religion. In essence, by applying quantum information, network and decision theory, it is demonstrated that an overarching evolutionary process shapes the spectrum of life and phenomena in the universe, as a generic paradigm beyond Darwin's original biology-based theory. The Theory of Evolution is undoubtedly the most powerful paradigm ever conceived by humans to explain their own existence. Since Darwin´s epoch-making treatise, Origin of Species', published in 1859, evolution has been centre-stage, universally recognised as the driving force in the emergence of modern humans from the genesis of life on this planet almost 4 billion years ago. However, despite its ubiquitous brilliance as the jewel in the crown of human intellectual achievement, the notion of evolution has never been developed to its full potential. It remains instead constrained within its biological cradle, often reduced in everyday connotation to its lowest common denominator of ´survival of the fittest´. The intention of this book to re-evaluate and expand the Darwinian model of evolution; to demonstrate that its current application is only the tip of the intellectual iceberg and that by combining its formidable biological principles with those of decision complexity, network, quantum and information theory, it emerges as an incalculably deeper and richer model than previously contemplated. It will be demonstrated that the evolutionary engine which drives biological development, also drives all other dynamic adaptive processes- the physical, social, cognitive, economic, political and technological and is in fact the major dynamic governing the Universe, past present and future. It is further proposed to demonstrate that recent developments in artificial intelligence and ubiquitous computing through the Internet, mark the next crucial stage in life's evolution, involving the inevitable symbiosis of vast computational intelligence with the human mind. The major hypothesis developed in this book, of a global all-encompassing Theory of Evolution, coupled with its potential for realising the emancipation of human intelligence and potential, provides a vastly more powerful paradigm for exploring the Future of Life than current scientific scenarios. The resulting Omega state of infinite knowledge and wisdom which is proposed, has been actively championed by a number of eminent 19th and 20th century philosophers such as Teillhard de Chardin, Henri Bergson, Schelling, Alfred Whitehead, Samuel Alexander and more recently by the leading physicist and futurist- Professor Frank Tipler. However to date no equivalent scientific framework for supporting such a hypothesis has been provided. In conclusion, The Future of Life: Meta-Evolution has been written not as an academic text but as primarily a non-technical review of the evidence to support such a hypothesis, in much the same vein as other recent publications in the popular science/philosophy genre. It is hoped that this approach will therefore provide a window into the wider evolutionary debate for the general reader interested in one of the most critical emerging paradigm shifts of the 21st century.

Life Stories

Author: Heather Newbold
Publisher: Univ of California Press
ISBN: 0520218965
Release Date: 2000
Genre: Biography & Autobiography

Compiles sixteen essays from such well-known scientists as Paul Ehrich, James Lovelock, David Suzuki, and Elliott Norse on the future of their field and the implications of their work.

Half Earth Our Planet s Fight for Life

Author: Edward O. Wilson
Publisher: W. W. Norton & Company
ISBN: 9781631490835
Release Date: 2016-03-07
Genre: Science

Half-Earth proposes an achievable plan to save our imperiled biosphere: devote half the surface of the Earth to nature. In order to stave off the mass extinction of species, including our own, we must move swiftly to preserve the biodiversity of our planet, says Edward O. Wilson in his most impassioned book to date. Half-Earth argues that the situation facing us is too large to be solved piecemeal and proposes a solution commensurate with the magnitude of the problem: dedicate fully half the surface of the Earth to nature. If we are to undertake such an ambitious endeavor, we first must understand just what the biosphere is, why it's essential to our survival, and the manifold threats now facing it. In doing so, Wilson describes how our species, in only a mere blink of geological time, became the architects and rulers of this epoch and outlines the consequences of this that will affect all of life, both ours and the natural world, far into the future. Half-Earth provides an enormously moving and naturalistic portrait of just what is being lost when we clip "twigs and eventually whole braches of life's family tree." In elegiac prose, Wilson documents the many ongoing extinctions that are imminent, paying tribute to creatures great and small, not the least of them the two Sumatran rhinos whom he encounters in captivity. Uniquely, Half-Earth considers not only the large animals and star species of plants but also the millions of invertebrate animals and microorganisms that, despite being overlooked, form the foundations of Earth's ecosystems. In stinging language, he avers that the biosphere does not belong to us and addresses many fallacious notions such as the idea that ongoing extinctions can be balanced out by the introduction of alien species into new ecosystems or that extinct species might be brought back through cloning. This includes a critique of the "anthropocenists," a fashionable collection of revisionist environmentalists who believe that the human species alone can be saved through engineering and technology. Despite the Earth's parlous condition, Wilson is no doomsayer, resigned to fatalism. Defying prevailing conventional wisdom, he suggests that we still have time to put aside half the Earth and identifies actual spots where Earth's biodiversity can still be reclaimed. Suffused with a profound Darwinian understanding of our planet's fragility, Half-Earth reverberates with an urgency like few other books, but it offers an attainable goal that we can strive for on behalf of all life.

The Bionarrative

Author: Stephen Boyden
Publisher: ANU Press
ISBN: 9781760460518
Release Date: 2016-08-19
Genre: Science

This book is for the general reader interested in the human place in nature and the future of civilisation. It is based on the biohistorical approach to the study of human situations. This approach recognises human culture as a new and extremely important force in the biosphere. The book discusses the evolution of life and the essential ecological processes on which all life, including human civilisation, depend. It describes the conditions of life and ecology of humans in the four ecological phases in human history, with emphasis on the impacts of human culture on biological systems. It explains how, as cultures evolved, they often came to embrace not only factual information of good practical value, but also assumptions that are sheer nonsense, sometimes leading to activities that caused unnecessary human distress or damage to local ecosystems. These are examples of cultural maladaptation. There have been countless instances of cultural maladaptation in human history. The days of the fourth ecological phase of human history, the Exponential Phase, are numbered. Cultural maladaptations are now on a massive scale, and business as usual will inevitably lead to the ecological collapse of civilisation. The only hope for the survival of civilisation lies in radical changes in the worldviews and priorities of the prevailing cultures of the world, leading to a fifth ecological phase — a phase in which human society is truly sensitive to, in tune with and respectful of the processes of life. This is called a biosensitive society. The book concludes with discussion on the essential characteristics of a biosensitive society and on the means by which the necessary cultural transformation might come about.

Dodging Extinction

Author: Anthony D. Barnosky
Publisher: Univ of California Press
ISBN: 9780520274372
Release Date: 2014-10-01
Genre: Nature

Paleobiologist Anthony D. Barnosky weaves together evidence from the deep past and the present to alert us to the looming Sixth Mass Extinction and to offer a practical, hopeful plan for avoiding it. Writing from the front lines of extinction research, Barnosky tells the overarching story of geologic and evolutionary history and how it informs the way humans inhabit, exploit, and impact Earth today. He presents compelling evidence that unless we rethink how we generate the power we use to run our global ecosystem, where we get our food, and how we make our money, we will trigger what would be the sixth great extinction on Earth, with dire consequences. Optimistic that we can change this ominous forecast if we act now, Barnosky provides clear-cut strategies to guide the planet away from global catastrophe. In many instances the necessary technology and know-how already exist and are being applied to crucial issues around human-caused climate change, feeding the world’s growing population, and exploiting natural resources. Deeply informed yet accessibly written, Dodging Extinction is nothing short of a guidebook for saving the planet.

Darwin s Devices

Author: John Long
Publisher: Basic Books
ISBN: 9780465029280
Release Date: 2012-04-03
Genre: Science

What happens when we let robots play the game of life? The challenge of studying evolution is that the history of life is buried in the past—we can’t witness the dramatic events that shaped the adaptations we see today. But biorobotics expert John Long has found an ingenious way to overcome this problem: he creates robots that look and behave like extinct animals, subjects them to evolutionary pressures, lets them compete for mates and resources, and mutates their ‘genes’. In short, he lets robots play the game of life. In Darwin’s Devices, Long tells the story of these evolving biorobots—how they came to be, and what they can teach us about the biology of living and extinct species. Evolving biorobots can replicate creatures that disappeared from the earth long ago, showing us in real time what happens in the face of unexpected environmental challenges. Biomechanically correct models of backbones functioning as part of an autonomous robot, for example, can help us understand why the first vertebrates evolved them. But the most impressive feature of these robots, as Long shows, is their ability to illustrate the power of evolution to solve difficult technological challenges autonomously—without human input regarding what a workable solution might be. Even a simple robot can create complex behavior, often learning or evolving greater intelligence than humans could possibly program. This remarkable idea could forever alter the face of engineering, design, and even warfare. An amazing tour through the workings of a fertile mind, Darwin’s Devices will make you rethink everything you thought you knew about evolution, robot intelligence, and life itself.

Learning for Life in the 21st Century

Author: Gordon Wells
Publisher: John Wiley & Sons
ISBN: 9780470752081
Release Date: 2008-04-15
Genre: Education

United by the belief that the most significant factor in shaping the minds of young people is the cultural setting in which learning takes place, the twenty eminent contributors to this volume present new thinking on education across the boundaries of school, home, work and community.

The Second Law of Life

Author: John E.J. Schmitz
Publisher: Elsevier
ISBN: 9780815519300
Release Date: 2007-01-22
Genre: Science

In this compelling, and important book, John Schmitz brings order to the world of chaos that surrounds us. The Second Law of Life refers to the second law of thermodynamics, entropy, which is an omnipresent force that quietly and crucially determines every aspect of our society, culture and daily lives. Unless we come to understand entropy, future generations will face consequences of the unstoppable laws of physics. Entropy explains the amount of energy no longer capable of doing work; in other words, wasted energy or heat loss. Each moment of every day, we lose irreplaceable energy and ômodernö technology is not helping. In fact, it is accelerating the problem at a catastrophic rate. û And we will ultimately face a heat death crisis and utter destruction of the Earth. Even actions we take to improve the environment may actually do more damage than good. For example, recycling is considered environmentally, socially and politically correct. Under the influence of entropy, however, it is a prolific waster of energy; we must look at entire systems, not just parts. It is critical that we find ways to reduce energy loss. Seeing the problems with greater clarity will lead to solutions. This fascinating and accessible journey through the second law of thermodynamics is a step in the right direction.

The Sixth Extinction

Author: Richard E. Leakey
Publisher: Anchor
ISBN: 9780385468091
Release Date: 1996
Genre: Science

Chronicling five times in the history of the earth in which more than half of all living species disappeared in a geological instant, a geological study states that we are on the brink of a sixth mass extinction and presents supporting evidence. Reprint.