The Future of Life Meta Evolution

Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut
ISBN: 9781425726843
Release Date: 2006-10-01
Genre: Science

The Future of Life: Meta-Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe, both organic and inorganic. These include all facets of human existence and civilisation- the sciences, technology, arts, humanities and religion. In essence, by applying quantum information, network and decision theory, it is demonstrated that an overarching evolutionary process shapes the spectrum of life and phenomena in the universe, as a generic paradigm beyond Darwin's original biology-based theory. The Theory of Evolution is undoubtedly the most powerful paradigm ever conceived by humans to explain their own existence. Since Darwin´s epoch-making treatise, Origin of Species', published in 1859, evolution has been centre-stage, universally recognised as the driving force in the emergence of modern humans from the genesis of life on this planet almost 4 billion years ago. However, despite its ubiquitous brilliance as the jewel in the crown of human intellectual achievement, the notion of evolution has never been developed to its full potential. It remains instead constrained within its biological cradle, often reduced in everyday connotation to its lowest common denominator of ´survival of the fittest´. The intention of this book to re-evaluate and expand the Darwinian model of evolution; to demonstrate that its current application is only the tip of the intellectual iceberg and that by combining its formidable biological principles with those of decision complexity, network, quantum and information theory, it emerges as an incalculably deeper and richer model than previously contemplated. It will be demonstrated that the evolutionary engine which drives biological development, also drives all other dynamic adaptive processes- the physical, social, cognitive, economic, political and technological and is in fact the major dynamic governing the Universe, past present and future. It is further proposed to demonstrate that recent developments in artificial intelligence and ubiquitous computing through the Internet, mark the next crucial stage in life's evolution, involving the inevitable symbiosis of vast computational intelligence with the human mind. The major hypothesis developed in this book, of a global all-encompassing Theory of Evolution, coupled with its potential for realising the emancipation of human intelligence and potential, provides a vastly more powerful paradigm for exploring the Future of Life than current scientific scenarios. The resulting Omega state of infinite knowledge and wisdom which is proposed, has been actively championed by a number of eminent 19th and 20th century philosophers such as Teillhard de Chardin, Henri Bergson, Schelling, Alfred Whitehead, Samuel Alexander and more recently by the leading physicist and futurist- Professor Frank Tipler. However to date no equivalent scientific framework for supporting such a hypothesis has been provided. In conclusion, The Future of Life: Meta-Evolution has been written not as an academic text but as primarily a non-technical review of the evidence to support such a hypothesis, in much the same vein as other recent publications in the popular science/philosophy genre. It is hoped that this approach will therefore provide a window into the wider evolutionary debate for the general reader interested in one of the most critical emerging paradigm shifts of the 21st century.

The Future of Life

Author: Edward O. Wilson
Publisher: Vintage
ISBN: 9780375414565
Release Date: 2002-04-09
Genre: Science

One of the world’s most important scientists, Edward O. Wilson is also an abundantly talented writer who has twice won the Pulitzer Prize. In this, his most personal and timely book to date, he assesses the precarious state of our environment, examining the mass extinctions occurring in our time and the natural treasures we are about to lose forever. Yet, rather than eschewing doomsday prophesies, he spells out a specific plan to save our world while there is still time. His vision is a hopeful one, as economically sound as it is environmentally necessary. Eloquent, practical and wise, this book should be read and studied by anyone concerned with the fate of the natural world.

The Future of Life on Earth

Author: Michael Bright
Publisher: Raintree
ISBN: 9781406232622
Release Date: 2013-02-01
Genre: Biodiversity

Explains how many of the living things on Earth are still to be found and described, as well as things that affect biodiversity and what our world might look like in years to come. Looks at ways that human activity is affecting biodiversity and how that may play out in the future of life on Earth based on past instances of mass extinction, and also looks forward to the time when the Sun will no longer support life on the planet.

The Future of Life and the Future of our Civilization

Author: Vladimir Burdyuzha
Publisher: Springer Science & Business Media
ISBN: 9781402049682
Release Date: 2006-10-12
Genre: Medical

This book covers the proceedings of "The Future of Life and the Future of our Civilization" symposium, held in Frankfurt, Germany in May 2005.

Dodging Extinction

Author: Anthony D. Barnosky
Publisher: Univ of California Press
ISBN: 9780520274372
Release Date: 2014-10-01
Genre: Nature

Paleobiologist Anthony D. Barnosky weaves together evidence from the deep past and the present to alert us to the looming Sixth Mass Extinction and to offer a practical, hopeful plan for avoiding it. Writing from the front lines of extinction research, Barnosky tells the overarching story of geologic and evolutionary history and how it informs the way humans inhabit, exploit, and impact Earth today. He presents compelling evidence that unless we rethink how we generate the power we use to run our global ecosystem, where we get our food, and how we make our money, we will trigger what would be the sixth great extinction on Earth, with dire consequences. Optimistic that we can change this ominous forecast if we act now, Barnosky provides clear-cut strategies to guide the planet away from global catastrophe. In many instances the necessary technology and know-how already exist and are being applied to crucial issues around human-caused climate change, feeding the world’s growing population, and exploiting natural resources. Deeply informed yet accessibly written, Dodging Extinction is nothing short of a guidebook for saving the planet.

The Future of Life A Unified Theory of Evolution

Author: David Hunter Tow
Publisher: Future of Life Media
ISBN:
Release Date: 2010-09-11
Genre: Science

The Future of Life: A Unified Theory of Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe- both organic and inorganic. In essence by combining information, decision, network and quantum theory, it is demonstrated that an overarching evolutionry process shapes the spectrum of life and all phenomena in the universe, beyond Darwin's original biological theory.

Globalization Biosecurity and the Future of the Life Sciences

Author: Committee on Advances in Technology and the Prevention of Their Application to Next Generation Biowarfare Threats
Publisher: National Academies Press
ISBN: 9780309100328
Release Date: 2006-06-07
Genre: Science

Biomedical advances have made it possible to identify and manipulate features of living organisms in useful ways—leading to improvements in public health, agriculture, and other areas. The globalization of scientific and technical expertise also means that many scientists and other individuals around the world are generating breakthroughs in the life sciences and related technologies. The risks posed by bioterrorism and the proliferation of biological weapons capabilities have increased concern about how the rapid advances in genetic engineering and biotechnology could enable the production of biological weapons with unique and unpredictable characteristics. Globalization, Biosecurity, and the Future of Life Sciences examines current trends and future objectives of research in public health, life sciences, and biomedical science that contain applications relevant to developments in biological weapons 5 to 10 years into the future and ways to anticipate, identify, and mitigate these dangers.

Creation

Author: Adam Rutherford
Publisher: Penguin UK
ISBN: 9780141970226
Release Date: 2013-04-04
Genre: Science

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

What is Life The Next Fifty Years

Author: Michael P. Murphy
Publisher: Cambridge University Press
ISBN: 0521599393
Release Date: 1997-03-13
Genre: Science

Erwin Schrödinger's book What is Life?, which was originally delivered as a set of lectures at Trinity College, Dublin, is perhaps one of the most important scientific books of the twentieth century. It marked the beginning of molecular biology, and stimulated scientists such as Watson and Crick to explore and discover the structure of DNA. The novelty and appeal of What is Life? is that Schrödinger addressed the central problems of biology--heredity and how organisms use energy to maintain order--from a physicist's perspective. Fifty years later, at Trinity College, a number of outstanding scientists from a range of disciplines gathered to celebrate the anniversary of Schrödinger's lectures. In this book, they present their views on the current main problems in biology. The contributors are eminent scientists (including two Nobel Laureates) and well-known writers of popular science, including Jared Diamond, Christien de Duve, Manfred Eigen, Stephen Jay Gould, Stuart Kauffman, John Maynard Smith, Roger Penrose, and Lewis Wolpert. They tackle questions on our current understanding of the origin of life, evolution, the origin of human inventiveness, developmental biology, and the basis for consciousness. The book ends with a touching biography by Schrödinger's daughter, Ruth Braunizer. This book will set the stage for biological research into the next century and is essential reading for anyone interested in biology and its future.

The Second Law of Life

Author: John E.J. Schmitz
Publisher: Elsevier
ISBN: 9780815519300
Release Date: 2007-01-22
Genre: Science

In this compelling, and important book, John Schmitz brings order to the world of chaos that surrounds us. The Second Law of Life refers to the second law of thermodynamics, entropy, which is an omnipresent force that quietly and crucially determines every aspect of our society, culture and daily lives. Unless we come to understand entropy, future generations will face consequences of the unstoppable laws of physics. Entropy explains the amount of energy no longer capable of doing work; in other words, wasted energy or heat loss. Each moment of every day, we lose irreplaceable energy and ômodernö technology is not helping. In fact, it is accelerating the problem at a catastrophic rate. û And we will ultimately face a heat death crisis and utter destruction of the Earth. Even actions we take to improve the environment may actually do more damage than good. For example, recycling is considered environmentally, socially and politically correct. Under the influence of entropy, however, it is a prolific waster of energy; we must look at entire systems, not just parts. It is critical that we find ways to reduce energy loss. Seeing the problems with greater clarity will lead to solutions. This fascinating and accessible journey through the second law of thermodynamics is a step in the right direction.

The Sixth Extinction

Author: Richard E. Leakey
Publisher: Anchor
ISBN: 9780385468091
Release Date: 1996
Genre: Science

Chronicling five times in the history of the earth in which more than half of all living species disappeared in a geological instant, a geological study states that we are on the brink of a sixth mass extinction and presents supporting evidence. Reprint.

Life 3 0

Author: Max Tegmark
Publisher: Vintage
ISBN: 9781101946602
Release Date: 2017-08-29
Genre: Technology & Engineering

New York Times Best Seller How will Artificial Intelligence affect crime, war, justice, jobs, society and our very sense of being human? The rise of AI has the potential to transform our future more than any other technology—and there’s nobody better qualified or situated to explore that future than Max Tegmark, an MIT professor who’s helped mainstream research on how to keep AI beneficial. How can we grow our prosperity through automation without leaving people lacking income or purpose? What career advice should we give today’s kids? How can we make future AI systems more robust, so that they do what we want without crashing, malfunctioning or getting hacked? Should we fear an arms race in lethal autonomous weapons? Will machines eventually outsmart us at all tasks, replacing humans on the job market and perhaps altogether? Will AI help life flourish like never before or give us more power than we can handle? What sort of future do you want? This book empowers you to join what may be the most important conversation of our time. It doesn’t shy away from the full range of viewpoints or from the most controversial issues—from superintelligence to meaning, consciousness and the ultimate physical limits on life in the cosmos.