The Future of Life

Author: Edward O. Wilson
Publisher: Vintage
ISBN: 0375414568
Release Date: 2002-04-09
Genre: Science

One of the world’s most important scientists, Edward O. Wilson is also an abundantly talented writer who has twice won the Pulitzer Prize. In this, his most personal and timely book to date, he assesses the precarious state of our environment, examining the mass extinctions occurring in our time and the natural treasures we are about to lose forever. Yet, rather than eschewing doomsday prophesies, he spells out a specific plan to save our world while there is still time. His vision is a hopeful one, as economically sound as it is environmentally necessary. Eloquent, practical and wise, this book should be read and studied by anyone concerned with the fate of the natural world.

Leben 3 0

Author: Max Tegmark
Publisher: Ullstein Buchverlage
ISBN: 9783843716703
Release Date: 2017-11-17
Genre: Social Science

Die Nobelpreis-Schmiede Massachusetts Institute of Technology ist der bedeutendste technologische Think Tank der USA. Dort arbeitet Professor Max Tegmark mit den weltweit führenden Entwicklern künstlicher Intelligenz zusammen, die ihm exklusive Einblicke in ihre Labors gewähren. Die Erkenntnisse, die er daraus zieht, sind atemberaubend und zutiefst verstörend zugleich. Neigt sich die Ära der Menschen dem Ende zu? Der Physikprofessor Max Tegmark zeigt anhand der neusten Forschung, was die Menschheit erwartet. Hier eine Auswahl möglicher Szenarien: - Eroberer: Künstliche Intelligenz übernimmt die Macht und entledigt sich der Menschheit mit Methoden, die wir noch nicht einmal verstehen. - Der versklavte Gott: Die Menschen bemächtigen sich einer superintelligenten künstlichen Intelligenz und nutzen sie, um Hochtechnologien herzustellen. - Umkehr: Der technologische Fortschritt wird radikal unterbunden und wir kehren zu einer prä-technologischen Gesellschaft im Stil der Amish zurück. - Selbstzerstörung: Superintelligenz wird nicht erreicht, weil sich die Menschheit vorher nuklear oder anders selbst vernichtet. - Egalitäres Utopia: Es gibt weder Superintelligenz noch Besitz, Menschen und kybernetische Organismen existieren friedlich nebeneinander. Max Tegmark bietet kluge und fundierte Zukunftsszenarien basierend auf seinen exklusiven Einblicken in die aktuelle Forschung zur künstlichen Intelligenz.

The Future of Life on Earth

Author: Michael Bright
Publisher: Raintree
ISBN: 9781406232622
Release Date: 2013-02-01
Genre: Biodiversity

Explains how many of the living things on Earth are still to be found and described, as well as things that affect biodiversity and what our world might look like in years to come. Looks at ways that human activity is affecting biodiversity and how that may play out in the future of life on Earth based on past instances of mass extinction, and also looks forward to the time when the Sun will no longer support life on the planet.

The Future of Life Meta Evolution

Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut
ISBN: 9781425726843
Release Date: 2006-10-01
Genre: Science

The Future of Life: Meta-Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe, both organic and inorganic. These include all facets of human existence and civilisation- the sciences, technology, arts, humanities and religion. In essence, by applying quantum information, network and decision theory, it is demonstrated that an overarching evolutionary process shapes the spectrum of life and phenomena in the universe, as a generic paradigm beyond Darwin's original biology-based theory. The Theory of Evolution is undoubtedly the most powerful paradigm ever conceived by humans to explain their own existence. Since Darwin´s epoch-making treatise, Origin of Species', published in 1859, evolution has been centre-stage, universally recognised as the driving force in the emergence of modern humans from the genesis of life on this planet almost 4 billion years ago. However, despite its ubiquitous brilliance as the jewel in the crown of human intellectual achievement, the notion of evolution has never been developed to its full potential. It remains instead constrained within its biological cradle, often reduced in everyday connotation to its lowest common denominator of ´survival of the fittest´. The intention of this book to re-evaluate and expand the Darwinian model of evolution; to demonstrate that its current application is only the tip of the intellectual iceberg and that by combining its formidable biological principles with those of decision complexity, network, quantum and information theory, it emerges as an incalculably deeper and richer model than previously contemplated. It will be demonstrated that the evolutionary engine which drives biological development, also drives all other dynamic adaptive processes- the physical, social, cognitive, economic, political and technological and is in fact the major dynamic governing the Universe, past present and future. It is further proposed to demonstrate that recent developments in artificial intelligence and ubiquitous computing through the Internet, mark the next crucial stage in life's evolution, involving the inevitable symbiosis of vast computational intelligence with the human mind. The major hypothesis developed in this book, of a global all-encompassing Theory of Evolution, coupled with its potential for realising the emancipation of human intelligence and potential, provides a vastly more powerful paradigm for exploring the Future of Life than current scientific scenarios. The resulting Omega state of infinite knowledge and wisdom which is proposed, has been actively championed by a number of eminent 19th and 20th century philosophers such as Teillhard de Chardin, Henri Bergson, Schelling, Alfred Whitehead, Samuel Alexander and more recently by the leading physicist and futurist- Professor Frank Tipler. However to date no equivalent scientific framework for supporting such a hypothesis has been provided. In conclusion, The Future of Life: Meta-Evolution has been written not as an academic text but as primarily a non-technical review of the evidence to support such a hypothesis, in much the same vein as other recent publications in the popular science/philosophy genre. It is hoped that this approach will therefore provide a window into the wider evolutionary debate for the general reader interested in one of the most critical emerging paradigm shifts of the 21st century.

The Future of Life and the Future of our Civilization

Author: Vladimir Burdyuzha
Publisher: Springer Science & Business Media
ISBN: 9781402049682
Release Date: 2006-10-12
Genre: Medical

This book covers the proceedings of "The Future of Life and the Future of our Civilization" symposium, held in Frankfurt, Germany in May 2005.

The Future of Life A Unified Theory of Evolution

Author: David Hunter Tow
Publisher: Future of Life Media
ISBN:
Release Date: 2010-09-11
Genre: Science

The Future of Life: A Unified Theory of Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe- both organic and inorganic. In essence by combining information, decision, network and quantum theory, it is demonstrated that an overarching evolutionry process shapes the spectrum of life and all phenomena in the universe, beyond Darwin's original biological theory.

The Second Law of Life

Author: John E.J. Schmitz
Publisher: Elsevier
ISBN: 9780815519300
Release Date: 2007-01-22
Genre: Science

In this compelling, and important book, John Schmitz brings order to the world of chaos that surrounds us. The Second Law of Life refers to the second law of thermodynamics, entropy, which is an omnipresent force that quietly and crucially determines every aspect of our society, culture and daily lives. Unless we come to understand entropy, future generations will face consequences of the unstoppable laws of physics. Entropy explains the amount of energy no longer capable of doing work; in other words, wasted energy or heat loss. Each moment of every day, we lose irreplaceable energy and ômodernö technology is not helping. In fact, it is accelerating the problem at a catastrophic rate. û And we will ultimately face a heat death crisis and utter destruction of the Earth. Even actions we take to improve the environment may actually do more damage than good. For example, recycling is considered environmentally, socially and politically correct. Under the influence of entropy, however, it is a prolific waster of energy; we must look at entire systems, not just parts. It is critical that we find ways to reduce energy loss. Seeing the problems with greater clarity will lead to solutions. This fascinating and accessible journey through the second law of thermodynamics is a step in the right direction.

Creation

Author: Adam Rutherford
Publisher: Penguin UK
ISBN: 9780141970226
Release Date: 2013-04-04
Genre: Science

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Beyond the Horizon Or Bright Side Chapters on the Future of Life

Author: Henry D. Kimball
Publisher: BiblioBazaar, LLC
ISBN: 1103380575
Release Date: 2009-02
Genre: History

This is a pre-1923 historical reproduction that was curated for quality. Quality assurance was conducted on each of these books in an attempt to remove books with imperfections introduced by the digitization process. Though we have made best efforts - the books may have occasional errors that do not impede the reading experience. We believe this work is culturally important and have elected to bring the book back into print as part of our continuing commitment to the preservation of printed works worldwide.

The Future of LIfe

Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut
ISBN:
Release Date: 1933
Genre: Future life


Dodging Extinction

Author: Anthony D. Barnosky
Publisher: Univ of California Press
ISBN: 9780520959095
Release Date: 2014-10-01
Genre: Nature

Paleobiologist Anthony D. Barnosky weaves together evidence from the deep past and the present to alert us to the looming Sixth Mass Extinction and to offer a practical, hopeful plan for avoiding it. Writing from the front lines of extinction research, Barnosky tells the overarching story of geologic and evolutionary history and how it informs the way humans inhabit, exploit, and impact Earth today. He presents compelling evidence that unless we rethink how we generate the power we use to run our global ecosystem, where we get our food, and how we make our money, we will trigger what would be the sixth great extinction on Earth, with dire consequences. Optimistic that we can change this ominous forecast if we act now, Barnosky provides clear-cut strategies to guide the planet away from global catastrophe. In many instances the necessary technology and know-how already exist and are being applied to crucial issues around human-caused climate change, feeding the world’s growing population, and exploiting natural resources. Deeply informed yet accessibly written, Dodging Extinction is nothing short of a guidebook for saving the planet.