The Future of Life

Author: Edward O. Wilson
Publisher: Vintage
ISBN: 9780679768111
Release Date: 2003
Genre: Nature

Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.

The Future of Life

Author: Edward O. Wilson
Publisher: Vintage
ISBN: 9780375414565
Release Date: 2002-04-09
Genre: Science

One of the world’s most important scientists, Edward O. Wilson is also an abundantly talented writer who has twice won the Pulitzer Prize. In this, his most personal and timely book to date, he assesses the precarious state of our environment, examining the mass extinctions occurring in our time and the natural treasures we are about to lose forever. Yet, rather than eschewing doomsday prophesies, he spells out a specific plan to save our world while there is still time. His vision is a hopeful one, as economically sound as it is environmentally necessary. Eloquent, practical and wise, this book should be read and studied by anyone concerned with the fate of the natural world.

The Future of Life

Author: Edward O. Wilson
Publisher: Knopf
ISBN: 9780679450788
Release Date: 2002-01-01
Genre: Nature

Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.

Life 3 0

Author: Max Tegmark
Publisher: Vintage
ISBN: 9781101946602
Release Date: 2017-08-29
Genre: Technology & Engineering

New York Times Best Seller How will Artificial Intelligence affect crime, war, justice, jobs, society and our very sense of being human? The rise of AI has the potential to transform our future more than any other technology—and there’s nobody better qualified or situated to explore that future than Max Tegmark, an MIT professor who’s helped mainstream research on how to keep AI beneficial. How can we grow our prosperity through automation without leaving people lacking income or purpose? What career advice should we give today’s kids? How can we make future AI systems more robust, so that they do what we want without crashing, malfunctioning or getting hacked? Should we fear an arms race in lethal autonomous weapons? Will machines eventually outsmart us at all tasks, replacing humans on the job market and perhaps altogether? Will AI help life flourish like never before or give us more power than we can handle? What sort of future do you want? This book empowers you to join what may be the most important conversation of our time. It doesn’t shy away from the full range of viewpoints or from the most controversial issues—from superintelligence to meaning, consciousness and the ultimate physical limits on life in the cosmos.

The Future of Life on Earth

Author: Michael Bright
Publisher: Capstone Classroom
ISBN: 9781410944337
Release Date: 2012-01-01
Genre: Juvenile Nonfiction

Looks at ways that human activity is affecting biodiversity and how that may play out in the future of life on Earth based on past instances of mass extinction, and also looks forward to the time when the Sun will no longer support life on the planet.

The Future of Life Meta Evolution

Author: David Hunter Tow
Publisher: Future of Life: Meta-Evolut
ISBN: 9781425726843
Release Date: 2006-10-01
Genre: Science

The Future of Life: Meta-Evolution represents the first comprehensive formulation of the hypothesis that evolution is the unifying force underlying the dynamics of all processes in the universe, both organic and inorganic. These include all facets of human existence and civilisation- the sciences, technology, arts, humanities and religion. In essence, by applying quantum information, network and decision theory, it is demonstrated that an overarching evolutionary process shapes the spectrum of life and phenomena in the universe, as a generic paradigm beyond Darwin's original biology-based theory. The Theory of Evolution is undoubtedly the most powerful paradigm ever conceived by humans to explain their own existence. Since Darwin´s epoch-making treatise, Origin of Species', published in 1859, evolution has been centre-stage, universally recognised as the driving force in the emergence of modern humans from the genesis of life on this planet almost 4 billion years ago. However, despite its ubiquitous brilliance as the jewel in the crown of human intellectual achievement, the notion of evolution has never been developed to its full potential. It remains instead constrained within its biological cradle, often reduced in everyday connotation to its lowest common denominator of ´survival of the fittest´. The intention of this book to re-evaluate and expand the Darwinian model of evolution; to demonstrate that its current application is only the tip of the intellectual iceberg and that by combining its formidable biological principles with those of decision complexity, network, quantum and information theory, it emerges as an incalculably deeper and richer model than previously contemplated. It will be demonstrated that the evolutionary engine which drives biological development, also drives all other dynamic adaptive processes- the physical, social, cognitive, economic, political and technological and is in fact the major dynamic governing the Universe, past present and future. It is further proposed to demonstrate that recent developments in artificial intelligence and ubiquitous computing through the Internet, mark the next crucial stage in life's evolution, involving the inevitable symbiosis of vast computational intelligence with the human mind. The major hypothesis developed in this book, of a global all-encompassing Theory of Evolution, coupled with its potential for realising the emancipation of human intelligence and potential, provides a vastly more powerful paradigm for exploring the Future of Life than current scientific scenarios. The resulting Omega state of infinite knowledge and wisdom which is proposed, has been actively championed by a number of eminent 19th and 20th century philosophers such as Teillhard de Chardin, Henri Bergson, Schelling, Alfred Whitehead, Samuel Alexander and more recently by the leading physicist and futurist- Professor Frank Tipler. However to date no equivalent scientific framework for supporting such a hypothesis has been provided. In conclusion, The Future of Life: Meta-Evolution has been written not as an academic text but as primarily a non-technical review of the evidence to support such a hypothesis, in much the same vein as other recent publications in the popular science/philosophy genre. It is hoped that this approach will therefore provide a window into the wider evolutionary debate for the general reader interested in one of the most critical emerging paradigm shifts of the 21st century.

The Future of Life and the Future of our Civilization

Author: Vladimir Burdyuzha
Publisher: Springer Science & Business Media
ISBN: 9781402049682
Release Date: 2006-10-12
Genre: Medical

This book covers the proceedings of "The Future of Life and the Future of our Civilization" symposium, held in Frankfurt, Germany in May 2005.

Half Earth Our Planet s Fight for Life

Author: Edward O. Wilson
Publisher: W. W. Norton & Company
ISBN: 9781631490835
Release Date: 2016-03-07
Genre: Science

Half-Earth proposes an achievable plan to save our imperiled biosphere: devote half the surface of the Earth to nature. In order to stave off the mass extinction of species, including our own, we must move swiftly to preserve the biodiversity of our planet, says Edward O. Wilson in his most impassioned book to date. Half-Earth argues that the situation facing us is too large to be solved piecemeal and proposes a solution commensurate with the magnitude of the problem: dedicate fully half the surface of the Earth to nature. If we are to undertake such an ambitious endeavor, we first must understand just what the biosphere is, why it's essential to our survival, and the manifold threats now facing it. In doing so, Wilson describes how our species, in only a mere blink of geological time, became the architects and rulers of this epoch and outlines the consequences of this that will affect all of life, both ours and the natural world, far into the future. Half-Earth provides an enormously moving and naturalistic portrait of just what is being lost when we clip "twigs and eventually whole braches of life's family tree." In elegiac prose, Wilson documents the many ongoing extinctions that are imminent, paying tribute to creatures great and small, not the least of them the two Sumatran rhinos whom he encounters in captivity. Uniquely, Half-Earth considers not only the large animals and star species of plants but also the millions of invertebrate animals and microorganisms that, despite being overlooked, form the foundations of Earth's ecosystems. In stinging language, he avers that the biosphere does not belong to us and addresses many fallacious notions such as the idea that ongoing extinctions can be balanced out by the introduction of alien species into new ecosystems or that extinct species might be brought back through cloning. This includes a critique of the "anthropocenists," a fashionable collection of revisionist environmentalists who believe that the human species alone can be saved through engineering and technology. Despite the Earth's parlous condition, Wilson is no doomsayer, resigned to fatalism. Defying prevailing conventional wisdom, he suggests that we still have time to put aside half the Earth and identifies actual spots where Earth's biodiversity can still be reclaimed. Suffused with a profound Darwinian understanding of our planet's fragility, Half-Earth reverberates with an urgency like few other books, but it offers an attainable goal that we can strive for on behalf of all life.

Dodging Extinction

Author: Anthony D. Barnosky
Publisher: Univ of California Press
ISBN: 9780520959095
Release Date: 2014-10-01
Genre: Nature

Paleobiologist Anthony D. Barnosky weaves together evidence from the deep past and the present to alert us to the looming Sixth Mass Extinction and to offer a practical, hopeful plan for avoiding it. Writing from the front lines of extinction research, Barnosky tells the overarching story of geologic and evolutionary history and how it informs the way humans inhabit, exploit, and impact Earth today. He presents compelling evidence that unless we rethink how we generate the power we use to run our global ecosystem, where we get our food, and how we make our money, we will trigger what would be the sixth great extinction on Earth, with dire consequences. Optimistic that we can change this ominous forecast if we act now, Barnosky provides clear-cut strategies to guide the planet away from global catastrophe. In many instances the necessary technology and know-how already exist and are being applied to crucial issues around human-caused climate change, feeding the world’s growing population, and exploiting natural resources. Deeply informed yet accessibly written, Dodging Extinction is nothing short of a guidebook for saving the planet.

Creation

Author: Adam Rutherford
Publisher: Penguin UK
ISBN: 9780141970226
Release Date: 2013-04-04
Genre: Science

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Genetics of Original Sin

Author: Christian de Duve
Publisher: Yale University Press
ISBN: 9780300168716
Release Date: 2010-12-14
Genre: Science

Increasingly absorbed in recent years by advances in our understanding of the origin of life, evolutionary history, and the advent of humankind, eminent biologist Christian de Duve of late has also pondered deeply the future of life on this planet. He speaks to readers with or without a scientific background, offering new perspectives on the threat posed by humanity’s immense biological success and on the resources human beings have for altering their current destructive path. Focusing on the process of natural selection, de Duve explores the inordinate and now dangerous rise of humankind. His explanation for this self-defeating success lies in the process of natural selection, which favors traits that are immediately useful, regardless of later consequences. Thus, the human genome determines such properties as tribal and group cohesion and collaboration and often fierce and irrational competition with and hostility toward other groups’ attributes that were once useful but now often ruinously dysfunctional. Christian de Duve suggests that these traits, imprinted into human nature by natural selection, may have been recognized by the writers of Genesis, thus inspiring the myth of original sin. Is there redemption for genetic original sin? In a brilliant and original conclusion, the author argues that, unique in the living world, humankind is endowed with the ability to deliberately oppose natural selection. Human beings have the capacity to devise measures that, while contrary to local or personal interests, can bring forth a safer world.

Technological Nature

Author: Peter H. Kahn
Publisher: MIT Press
ISBN: 9780262113229
Release Date: 2011
Genre: Nature

Why it matters that our relationship with nature is increasingly mediated and augmented by technology.

The Sixth Extinction

Author: Richard E. Leakey
Publisher: Anchor
ISBN: 9780385468091
Release Date: 1996
Genre: Science

Chronicling five times in the history of the earth in which more than half of all living species disappeared in a geological instant, a geological study states that we are on the brink of a sixth mass extinction and presents supporting evidence. Reprint.

Superintelligence

Author: Nick Bostrom
Publisher: Oxford University Press (UK)
ISBN: 9780199678112
Release Date: 2014
Genre: Computers

The human brain has some capabilities that the brains of other animals lack. It is to these distinctive capabilities that our species owes its dominant position. Other animals have stronger muscles or sharper claws, but we have cleverer brains. If machine brains one day come to surpass human brains in general intelligence, then this new superintelligence could become very powerful. As the fate of the gorillas now depends more on us humans than on the gorillas themselves, so the fate of our species then would come to depend on the actions of the machine superintelligence. But we have one advantage: we get to make the first move. Will it be possible to construct a seed AI or otherwise to engineer initial conditions so as to make an intelligence explosion survivable? How could one achieve a controlled detonation? To get closer to an answer to this question, we must make our way through a fascinating landscape of topics and considerations. Read the book and learn about oracles, genies, singletons; about boxing methods, tripwires, and mind crime; about humanity's cosmic endowment and differential technological development; indirect normativity, instrumental convergence, whole brain emulation and technology couplings; Malthusian economics and dystopian evolution; artificial intelligence, and biological cognitive enhancement, and collective intelligence.

The Next Species

Author: Michael Tennesen
Publisher: Simon and Schuster
ISBN: 9781451677515
Release Date: 2015-03-17
Genre: Science

Delving into the history of the planet and based on reports and interviews with top scientists, a prominent science writer, traveling to rain forests, canyons, craters and caves all over the world to explore the potential winners and losers of the next era of evolution, describes what life on earth could look like after the next mass extinction. Includes timeline.